Recubrimientos de cerámica y vidrio nanoestructurados para aplicaciones ortopédicas, parte 3


2.2 Fuerza de unión y microdureza.

   La resistencia de unión a la tracción entre el revestimiento y   sustrato   estaba   mesurado   en   conformidad   con   ASTM   C-633-79.   los   pruebas   procedimiento   puede   ser   encontró   en   Nuestro trabajo anterior [ 32 ]. Se analizaron cinco muestras de forma independiente.   para   cada   tipo   de   revestimientos   y   la   resultados   fueron reportados   como   media ± sd

La microdureza de los recubrimientos se probó en superficies de recubrimiento pulidas utilizando un probador de dureza Shimadzu (Shimadzu Co., Japón) con una carga de 300 gf y   una   cargando   hora   de   15 s.   antes de   pruebas,   revestimientos   fueron sometidos   a   bien   pulido.   Dureza   valores   fueron grabados   en   15   diferente   posiciones  

los   resultados   se presentan   como   media ± sd

 


Tabla 1. Cebadores utilizados para RT-PCR: marcadores relacionados con el HOB.


gene

secuencia   ( 5 '   - 3 ' )

temperatura de fusión (℃)

GAPDH

F ACCCAGAAGACTGTGGATGG

60


R CAGTGAGCTTCCCGTTCAG


Runx-2

F ATGCTTCATTCGCCTCAC

60


R ACTGCTTGCAGCCTTAAAT


OPN

F TTCCAAGTAAGTCCAACGAAAG

60


R GTGACCAGTTCATCAGATTCAT


colágeno tipo I

F AGGGTCCCAACGAGATCGAGATCCG

60


R TACAGGAAGCAGACAGGGCCAACGTCG


BSP

F ATGGCCTGTGCTTTCTCAATG

60


R GGATAAAAGTAGGCATGCTTG


 


2.3. Liberación de iones y pruebas de mineralización acelular.

     Para medir los comportamientos de liberación iónica de los recubrimientos de HT y SP, se sumergieron durante 7 días en una solución de 15 ml de cloruro de sodio (pH 7,4) tamponada con tris (hidroximetil) aminometano y ácido clorhídrico (solución amortiguada de HCl-Tris). Después de la inmersión, se midieron los valores de pH de la solución tamponada y se analizaron las concentraciones de iones mediante espectroscopia de emisión atómica por plasma inducida inductivamente (ICP-OES, Optima 3000 DV, EE. UU.).

La capacidad de los recubrimientos para inducir la precipitación de compuestos de Ca y fósforo (P) se evaluó sumergiendo los recubrimientos en un medio de cultivo libre de células. Brevemente, los recubrimientos se esterilizaron por inmersión en solución de etanol al 70% durante la noche, y luego se lavaron con solución salina tamponada con fosfato (PBS) antes de remojar en medio de cultivo. Se agregaron tres mililitros de medio de cultivo a cada pocillo de la placa de cultivo de 12 pocillos que contenía muestras de recubrimiento. Las muestras de recubrimiento se incubaron a 37 ° C en una atmósfera humidificada de CO2 al 5 por ciento durante 5 hy luego se lavaron con agua ultrapura, se secaron y se extrajeron con carbón para la observación SEM. La composición química de los depósitos formados en la superficie del recubrimiento después de la mineralización se analizó mediante espectroscopia de dispersión de energía (EDS), que se adjuntó al instrumento SEM.


2.4. Aislamiento y cultivo de osteoblastos humanos primarios.

El Comité de Ética Humana de la Universidad de Sydney otorgó el permiso para utilizar tejido humano desechado y se obtuvo el consentimiento informado. Los osteoblastos humanos primarios (HOB) se aislaron a partir de hueso trabecular humano normal como se describió anteriormente [34]. Brevemente, el hueso se dividió en piezas de 1 mm3, se lavó varias veces en PBS y se digirió con tripsina al 0.02 por ciento (p / v) (Sigma -Aldrich, EE. UU.) En PBS, pH 7.4, durante 90 min a 37 ℃. Las células se cultivaron luego en un medio completo que contenía un medio esencial mínimo (a-MEM, Gibco Laboratories, EE. UU.), Complementado con un 10 por ciento (v / v) de suero de ternera fetal inactivado por calor (FCS, Gibco Laboratories), 2 mM L-glutamina (Gibco Laboratories), tampón Hepes 25 mM (Gibco Laboratories), piruvato de sodio 2 mM, 30 mg ml -1 de penicilina, 100 mg ml -1 de estreptomicina (Gibco Laboratories) y sal de magnesio fosfato de ácido L-ascórbico 0,1 mM ( Wako Pure Chemicals, Osaka, Japón). Las células se cultivaron a 37 en una atmósfera de 5% de CO2 y los medios se actualizaron cada tres días. Tras la confluencia, las células se pasaron y las del pase 3 se usaron en los experimentos.



2.5. Acoplamiento celular y observación morfológica.

Una vez que las células alcanzaron una confluencia del 80–90%, se sintetizaron mediante TrypLE Express (Invitrogen), posteriormente se centrifugaron y se suspendieron en medios completos para producir una suspensión celular con una densidad de 3,4 × 10 4 células por mililitro. Luego, se añadió una suspensión celular de 1 ml a cada pocillo de una placa de cultivo celular de 24 pocillos que contenía muestras de recubrimiento. Después de cultivar durante 2, 5 y 24 h, las células se fijaron en una solución de paraformaldehído al 4 por ciento , se fijaron posteriormente con tetróxido de osmio al 1 por ciento en PBS durante 1 h, luego se deshidrataron en una serie de soluciones de etanol graduadas (30, 50, 70, 90, 95 y 100%), y finalmente se secó en hexametildisilizano durante 3 min. Las muestras de revestimiento secas se pulverizaron con oro antes de la observación SEM.



2.6. Ensayo de proliferación celular

Se utilizó el ensayo acuoso CellTiter 96 (Promega, EE. UU.), Un método colorimétrico, para determinar el número de células viables. El ensayo es una solución combinada de tetrazolio compuesto 3- (4,5-dimetiltiazol-2-il) -5- (3-carboximetoxifenil) -2- (4-sulfofenil-2H-tetrazolio) (MTS) y un reactivo de acoplamiento de electrones. (fenosfosfosfato) con una proporción en volumen de 20: 1. El primer compuesto puede ser biorreducido por células viables en un formazán, que es soluble en medio de cultivo celular. Por lo tanto, la absorbancia del formazán a 490 nm es directamente proporcional al número de células viables. Se probaron cuatro muestras de cada tipo de recubrimientos para cada punto de tiempo y los discos de Ti-6Al-4V no recubiertos se utilizaron como control. Brevemente, se añadió 1 ml de suspensión celular con una densidad celular de 8,5 x 10 4 ml ml -1 en cada pocillo de una placa de cultivo de 24 pocillos que contenía las muestras de recubrimiento. Después de 3 y 7 días, el medio de cultivo se reemplazó por 700 µl de la solución de trabajo MTS, que era una solución diluida cinco veces del ensayo acuoso CellTiter 96 en PBS. Después de 4 h de incubación adicional, se transfirieron 100 ml de la solución de trabajo a una placa de cultivo celular de 96 pocillos para medir la absorbancia utilizando un lector de microplacas (PathTech) a 490 nm.


2.7. Reacción en cadena de polimerasa en tiempo real cuantitativa

Se sembraron HOB en las muestras de recubrimiento a una densidad celular de 2 × 10 4 células cm -2 y se cultivaron durante 1 día y 7 días. Después de cada punto de tiempo, se aisló el ARN total d de las HOB cultivadas en muestras de recubrimiento y las muestras de control de discos de Ti-6Al-4V sin recubrir utilizando Trizol (Sigma) siguiendo las instrucciones del fabricante. El ADNc de la primera cadena se sintetizó a partir de 0,7 µg de ARN total utilizando el kit Omniscript RT Kit (Qiagen, EE. UU.) De acuerdo con las instrucciones del fabricante. Luego se analizó el ADNc mediante PCR en tiempo real (Rotor-Gene 6000, Corbett Life Science) para los genes relacionados con osteoblastos: Runx-2, colágeno tipo I, osteopontina (OPN) y sialoproteína ósea (BSP) y su expresión génica relativa los niveles se obtuvieron mediante la normalización a gliceraldehído 3-fosfato deshidrogenasa (GAPDH).

Los cebadores utilizados para los genes seleccionados se enumeran en la tabla 1.


2.8. análisis estadístico

Los datos se obtuvieron de cuatro experimentos independientes y se expresaron como media ± sd. Para el análisis estadístico , se utilizó el programa SPSS 17.0. La prueba de Levene se realizó para determinar la homogeneidad de la varianza para todos los datos, y luego se usaron las pruebas post hoc de Tukey HSD para los datos con la varianza homogénea; de lo contrario, se empleó el T2 post hoc de Tamhane.

Un valor de p inferior a 0,05 se consideró significativo.



******continuará******